WormMine: Gene WBGene00133156

• WormBase Gene ID: WBGene00133156
• Gene Name: Cjp-kvs-1
• Sequence Name: CJA13952
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable voltage-gated potassium channel activity. Predicted to be involved in potassium ion transport; protein homooligomerization; and transmembrane transport. Predicted to be located in membrane. Predicted to be part of voltage-gated potassium channel complex. Is an ortholog of C. elegans kvs-1. In C. elegans, kvs-1 is involved in several processes, including forward locomotion; hyperosmotic response; and mechanosensory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13952a.1	CJA13952a.1		[unknown]
Transcript:CJA13952b.1	CJA13952b.1		[unknown]
Transcript:CJA13952c.1	CJA13952c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13952a	CJA13952a		[unknown]
CDS:CJA13952c	CJA13952c		[unknown]
CDS:CJA13952b	CJA13952b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085682
• Remark: Cjp-kvs-1, GTGGTGTTTTGGTGCTTGCTCTTCCTATCACTATTATTGTTGATAATTTCATGAAAGTTT, WBGene00133156
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region