WormMine: Gene WBGene00133170

• WormBase Gene ID: WBGene00133170
• Gene Name: Cjp-mig-10
• Sequence Name: CJA13966
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans mig-10. In C. elegans, mig-10 is involved in several processes, including cell migration; cell projection organization; and egg-laying behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13966b.1	CJA13966b.1		[unknown]
Transcript:CJA13966c.1	CJA13966c.1		[unknown]
Transcript:CJA13966a.1	CJA13966a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13966c	CJA13966c		[unknown]
CDS:CJA13966b	CJA13966b		[unknown]
CDS:CJA13966a	CJA13966a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080065
• Remark: Cjp-mig-10, GCAAGGACCCGCGAAGAATGATCTCGAGGCGGCGTTGGCGAGAAGGCGGGAGAAGATGGC, WBGene00133170
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region