WormMine: Gene WBGene00133390

• WormBase Gene ID: WBGene00133390
• Gene Name: Cjp-glc-3
• Sequence Name: CJA14186
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable extracellular ligand-gated monoatomic ion channel activity and transmembrane signaling receptor activity. Predicted to be involved in monoatomic ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans glc-3. In C. elegans, glc-3 is involved in locomotion involved in locomotory behavior; sensory perception of chemical stimulus; and sensory processing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14186a.1	CJA14186a.1		[unknown]
Transcript:CJA14186b.1	CJA14186b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14186b	CJA14186b		[unknown]
CDS:CJA14186a	CJA14186a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077984
• Remark: Cjp-glc-3, GCCCTATTTCCATTTTTCTTCGTCTGCTTCAATGTGCTCTATTGGACAAGCTACTCGTAA, WBGene00133390
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region