WormMine: Gene WBGene00133452

• WormBase Gene ID: WBGene00133452
• Gene Name: Cjp-nhr-34
• Sequence Name: CJA14248
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable nuclear steroid receptor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans nhr-34.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14248b.1	CJA14248b.1		[unknown]
Transcript:CJA14248a.1	CJA14248a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14248a	CJA14248a		[unknown]
CDS:CJA14248b	CJA14248b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076791
• Remark: Cjp-nhr-34, TAAAACGTGTGCGCGACAAGTACATTGAAGCGCTCTACCAACACGTCCAGCACCAACACC, WBGene00133452
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region