WormMine: Gene WBGene00133518

• WormBase Gene ID: WBGene00133518
• Gene Name: Cjp-atf-7
• Sequence Name: CJA14314
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans atf-7. In C. elegans, atf-7 is involved in several processes, including defense response to bacterium; regulation of innate immune response; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14314.2	CJA14314.2		[unknown]
Transcript:CJA14314.1	CJA14314.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14314	CJA14314		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072283
• Remark: Cjp-atf-7, TTTTGAACGAACGAGAGGCCAGATGTGTGTGTCTGAAGGGCATTCCGATGACTGACGAAC, WBGene00133518
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region