WormMine: Gene WBGene00133529

• WormBase Gene ID: WBGene00133529
• Gene Name: Cjp-ceh-12
• Sequence Name: CJA14325
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in spinal cord motor neuron cell fate specification. Is an ortholog of C. elegans ceh-12. In C. elegans, ceh-12 is involved in negative regulation of gene expression and neuron fate specification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14325.1	CJA14325.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14325	CJA14325		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079622
• Remark: Cjp-ceh-12, CAGCTTCTCAAGCCTACAGAAGAACTAAGAAAATCATCCCGTTCGCCAGATTCCCCTATC, WBGene00133529
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region