WormMine: Gene WBGene00133545

• WormBase Gene ID: WBGene00133545
• Gene Name: Cjp-dhc-1
• Sequence Name: CJA14341
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and minus-end-directed microtubule motor activity. Predicted to be involved in microtubule-based movement. Predicted to be part of dynein complex. Is an ortholog of C. elegans dhc-1. In C. elegans, dhc-1 is involved in several processes, including neuron remodeling; organelle localization; and regulation of cellular localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14341.1	CJA14341.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14341	CJA14341		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074040
• Remark: CJA14684, CCAAACAATGTCAACTGATGATTACGTGGAATGGCTCGACAAGTATCCGTCTCAAGTCAT, WBGene00133888
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region