WormMine: Gene WBGene00133778

• WormBase Gene ID: WBGene00133778
• Gene Name: Cjp-lgmn-1
• Sequence Name: CJA14574
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable cysteine-type endopeptidase activity. Predicted to be involved in proteolysis involved in protein catabolic process. Is an ortholog of C. elegans lgmn-1. In C. elegans, lgmn-1 is involved in PERK-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14574.1	CJA14574.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14574	CJA14574		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075321
• Remark: CJA14574, CAGTGATGGAGAAGACTTGACGACGGAGACTCTCGAGTTTCAGTACGAGCTGGTGAAAAA, WBGene00133778
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region