WormMine: Gene WBGene00133886

• WormBase Gene ID: WBGene00133886
• Gene Name: Cjp-iff-2
• Sequence Name: CJA14682
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA binding activity; ribosome binding activity; and translation elongation factor activity. Predicted to be involved in positive regulation of translational elongation and positive regulation of translational termination. Is an ortholog of C. elegans iff-2. In C. elegans, iff-2 is involved in gamete generation; nematode larval development; and sex differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14682.1	CJA14682.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14682	CJA14682		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079645
• Remark: Cjp-iff-2, AAAGGAGGACCTTAAGGTCCCAGAGAACGAGATCGGAACACAGATTCAGGAGGCTCTTAA, WBGene00133886
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region