WormMine: Gene WBGene00133971

• WormBase Gene ID: WBGene00133971
• Gene Name: Cjp-pah-1
• Sequence Name: CJA14767
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable iron ion binding activity and phenylalanine 4-monooxygenase activity. Predicted to be involved in L-phenylalanine catabolic process. Is an ortholog of C. elegans pah-1. In C. elegans, pah-1 is involved in several processes, including aromatic amino acid metabolic process; collagen and cuticulin-based cuticle development; and determination of adult lifespan.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14767.1	CJA14767.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14767	CJA14767		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074165
• Remark: Cjp-pah-1, TCTTGCACGTGATATTAGAAGTGATATTTCGACGTTGGAGGATGCGCTTGGAAAAGTTAA, WBGene00133971
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region