WormMine: Gene WBGene00133978

• WormBase Gene ID: WBGene00133978
• Gene Name: Cjp-pign-1.1
• Sequence Name: CJA14774
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable mannose-ethanolamine phosphotransferase activity. Predicted to be involved in GPI anchor biosynthetic process. Predicted to be located in endoplasmic reticulum membrane. Is an ortholog of C. elegans pign-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14774.1	CJA14774.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14774	CJA14774		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078096
• Remark: CJA14774, TTTTTGGTGGATCGATTGGTGGCATATTCGTTGTGCTTTTATGTGAGTTCATTTATAAAA, WBGene00133978
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region