WormMine: Gene WBGene00134122

• WormBase Gene ID: WBGene00134122
• Gene Name: CJA14918
• Sequence Name: CJA14918
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable nucleic acid binding activity and zinc ion binding activity. Predicted to be involved in transcription elongation by RNA polymerase II. Predicted to be located in nucleus. Is an ortholog of C. elegans T24H10.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14918.1	CJA14918.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14918	CJA14918		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077865
• Remark: CJA14918, GAAAGTGTGGCAAGAAGAATTGCACGTACACGCAGCTACAAACGCGCTCCTCTGACGAGC, WBGene00134122
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region