WormMine: Gene WBGene00134137

• WormBase Gene ID: WBGene00134137
• Gene Name: Cjp-tyms-1
• Sequence Name: CJA14933
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable thymidylate synthase activity. Predicted to be involved in dTMP biosynthetic process. Is an ortholog of C. elegans tyms-1. In C. elegans, tyms-1 is involved in dTMP biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14933.1	CJA14933.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14933	CJA14933		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091487
• Remark: CJA14933, AACCACGTGGATGCGTTGAAAACGCAGCTGCTCCGCGAGCCGTACTCTTTCCCAAAGATT, WBGene00134137
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region