WormMine: Gene WBGene00134161

• WormBase Gene ID: WBGene00134161
• Gene Name: Cjp-cnt-1
• Sequence Name: CJA14957
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable GTPase activator activity. Is an ortholog of C. elegans cnt-1. In C. elegans, cnt-1 is involved in apoptotic process; negative regulation of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate biosynthetic process; and positive regulation of endosome to plasma membrane protein transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14957.1	CJA14957.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14957	CJA14957		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072171
• Remark: Cjp-cnt-1, AAACGAGGCGCTGACAACAATTTGGCCAACGTGGACAGCAAAACGCCATTGGACATTGCG, WBGene00134161
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region