WormMine: Gene WBGene00134215

• WormBase Gene ID: WBGene00134215
• Gene Name: Cjp-cebp-2
• Sequence Name: CJA15011
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans cebp-2. In C. elegans, cebp-2 is involved in defense response to Gram-negative bacterium; regulation of lipid metabolic process; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15011.1	CJA15011.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15011	CJA15011		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086144
• Remark: CJA15011, GTACGCGAAAAACGACGGAAATAACGATGGAAACGGTCAGCCACCGTCGAGCACTTCATC, WBGene00134215
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region