WormMine: Gene WBGene00134500

• WormBase Gene ID: WBGene00134500
• Gene Name: Cjp-tln-1
• Sequence Name: CJA15296
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable actin filament binding activity. Predicted to be involved in cell adhesion. Is an ortholog of C. elegans tln-1. In C. elegans, tln-1 is involved in negative regulation of epidermal growth factor receptor signaling pathway; regulation of vulval development; and vulval cell fate specification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15296a.1	CJA15296a.1		[unknown]
Transcript:CJA15296b.1	CJA15296b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15296a	CJA15296a		[unknown]
CDS:CJA15296b	CJA15296b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089222
• Remark: CJA15296, GGAATCGCACAAGTCATGGACGCTCAAGAAGAGGTGCTCCGAAAAGAGAAGGAGCTCGGC, WBGene00134500
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region