WormMine: Gene WBGene00134563

• WormBase Gene ID: WBGene00134563
• Gene Name: Cjp-dcs-1
• Sequence Name: CJA15359
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable hydrolase activity. Predicted to be involved in deadenylation-dependent decapping of nuclear-transcribed mRNA. Is an ortholog of C. elegans dcs-1. In C. elegans, dcs-1 is involved in several processes, including mRNA metabolic process; purine ribonucleotide metabolic process; and response to heat.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15359.1	CJA15359.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15359	CJA15359		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089759
• Remark: Cjp-dcs-1, CCATGTCAGCTATACTTTTGGACGACGTTATCAACAATTTGGAGCTTAACTCGCAGCATT, WBGene00134563
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region