WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134619 Gene Name  Cjp-let-363
Sequence Name  ? CJA15415 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable protein serine/threonine kinase activity. Is an ortholog of C. elegans let-363. In C. elegans, let-363 is involved in several processes, including box C/D snoRNP assembly; determination of adult lifespan; and regulation of gene expression. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15415a.1 CJA15415a.1   [unknown]
Transcript:CJA15415b.1 CJA15415b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15415a CJA15415a   [unknown]
CDS:CJA15415b CJA15415b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-let-363, GCATGAATATTAAAATGCGCGGGCGGTGGTACGAGAAGCTGAACGAGTGGGAGAAAGCCC, WBGene00134619   Expr1077247 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA10430, GTGGAGCTGAAATTGTGAAGAATTTGAAGCCGTTGTTCGAGAAGCTGACGCACATGATCA, WBGene00129634   Expr1081645 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region