WormMine: Gene WBGene00134640

• WormBase Gene ID: WBGene00134640
• Gene Name: Cjp-mys-1
• Sequence Name: CJA15436
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable histone acetyltransferase activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans mys-1. In C. elegans, mys-1 is involved in several processes, including negative regulation of DNA-templated transcription; negative regulation of cell fate specification; and protein localization to chromatin.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15436.1	CJA15436.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15436	CJA15436		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079163
• Remark: Cjp-mys-1, CGAAGAAGAAGAGGCGCATCAATCCGACAGCATTGCAGTGGCGGCCCAAAGAGTATGGCA, WBGene00134640
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region