WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00134911 Gene Name  Cjp-unc-31
Sequence Name  ? CJA15707 Organism  Caenorhabditis japonica
Automated Description  Predicted to be involved in dense core granule exocytosis and synaptic vesicle exocytosis. Is an ortholog of C. elegans unc-31. In C. elegans, unc-31 is involved in several processes, including cellular response to carbon dioxide; regulation of multicellular organismal process; and signal release. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA15707.1 CJA15707.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA15707 CJA15707   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-unc-31, ATCAGATGAAAGCAATCAACGAGTGGCTTACCGAACGACTTCAACAATCGCTGAGCGCCA, WBGene00134911   Expr1075686 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA23756, TCACACCGAAATTCGTGGTGAAAGACATGGAAACGTTGTACATGGATGAAGTGAGAATGT, WBGene00179328   Expr1082965 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region