WormMine: Gene WBGene00135117

• WormBase Gene ID: WBGene00135117
• Gene Name: Cjp-tax-2
• Sequence Name: CJA15913
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable monoatomic ion channel activity. Predicted to be involved in monoatomic ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans tax-2. In C. elegans, tax-2 is involved in several processes, including G protein-coupled receptor signaling pathway coupled to cGMP nucleotide second messenger; positive regulation of macromolecule biosynthetic process; and thermosensory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15913a.1	CJA15913a.1		[unknown]
Transcript:CJA15913c.1	CJA15913c.1		[unknown]
Transcript:CJA15913b.1	CJA15913b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15913c	CJA15913c		[unknown]
CDS:CJA15913b	CJA15913b		[unknown]
CDS:CJA15913a	CJA15913a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086760
• Remark: Cjp-tax-2, GCGCCAAGGGTTACTGTACCTTGTTTGTGCTCGCCAAAGAGGACCTGAACGACGTGATAC, WBGene00135117
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region