WormMine: Gene WBGene00135498

• WormBase Gene ID: WBGene00135498
• Gene Name: Cjp-npr-10
• Sequence Name: CJA16294
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable neuropeptide Y receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans npr-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16294a.1	CJA16294a.1		[unknown]
Transcript:CJA16294b.1	CJA16294b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16294b	CJA16294b		[unknown]
CDS:CJA16294a	CJA16294a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087944
• Remark: CJA16294, TTTTTTGCGAGATTATTCGGCTCTTCCAAGCATCATCAACAAACAAGACTACTTGTTCGG, WBGene00135498
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region