WormMine: Gene WBGene00135665

• WormBase Gene ID: WBGene00135665
• Gene Name: Cjp-daf-6
• Sequence Name: CJA16460
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in neuropeptide signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans daf-6. In C. elegans, daf-6 is involved in several processes, including negative regulation of transcription by RNA polymerase II; positive regulation of dauer larval development; and regulation of insulin receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16460b.1	CJA16460b.1		[unknown]
Transcript:CJA16460a.1	CJA16460a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16460b	CJA16460b		[unknown]
CDS:CJA16460a	CJA16460a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075397
• Remark: Cjp-flp-8, TTTATTCGATTTGGAAAGCGAAAGAATGAGTTCATTCGTTTTGGAAGATCGGACCCGGAA, WBGene00137563
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region