WormMine: Gene WBGene00135679

• WormBase Gene ID: WBGene00135679
• Gene Name: Cjp-npp-1
• Sequence Name: CJA16475
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be part of nuclear pore. Is an ortholog of C. elegans npp-1. In C. elegans, npp-1 is involved in several processes, including establishment of mitotic spindle orientation; nuclear pore organization; and positive regulation of mitotic cell cycle, embryonic.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16475b.1	CJA16475b.1		[unknown]
Transcript:CJA16475a.1	CJA16475a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16475b	CJA16475b		[unknown]
CDS:CJA16475a	CJA16475a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080148
• Remark: Cjp-npp-1, GTGCCAACGTGGAAATGGAACAGATTCGTAACCGACACAAACAACTCTCGTATCGATTGA, WBGene00135679
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region