WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135958 Gene Name  Cjp-mdt-15
Sequence Name  ? CJA16754 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable transcription coregulator activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans mdt-15. In C. elegans, mdt-15 is involved in several processes, including determination of adult lifespan; regulation of primary metabolic process; and sequestering of triglyceride. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16754.1 CJA16754.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16754 CJA16754   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-mdt-15, GCAAAATGCAGTCTACGAACGATTGTCGAGGCCCGGAATCACGTCACTCACGGATTATTT, WBGene00135958   Expr1086010 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA21428, GAAGAATACGTGTTCGCCAAGTGTGTGTCCAAAGATGAATACATGCGGACGATTGCCAAG, WBGene00177000   Expr1077557 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region