WormMine: Gene WBGene00135987

• WormBase Gene ID: WBGene00135987
• Gene Name: Cjp-unc-112
• Sequence Name: CJA16784
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in integrin-mediated signaling pathway. Is an ortholog of C. elegans unc-112. In C. elegans, unc-112 is involved in several processes, including muscle cell cellular homeostasis; positive regulation of supramolecular fiber organization; and regulation of engulfment of apoptotic cell.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16784.1	CJA16784.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16784	CJA16784		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080028
• Remark: Cjp-unc-112, GAACAGCAGAAAGGCGGATTTGATTGGCGTAGCGGTGAATCGGCTCGTCAAAATGGGCGT, WBGene00135987
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region