WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00135997 Gene Name  Cjp-unc-53
Sequence Name  ? CJA16793 Organism  Caenorhabditis japonica
Automated Description  Predicted to be involved in neurogenesis. Is an ortholog of C. elegans unc-53. In C. elegans, unc-53 is involved in several processes, including backward locomotion; positive regulation of locomotion; and reproductive behavior. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16793b.1 CJA16793b.1   [unknown]
Transcript:CJA16793a.1 CJA16793a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16793a CJA16793a   [unknown]
CDS:CJA16793b CJA16793b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-unc-53, GAGAAATGGCCGTGGTTCGACGGTGCAAATCCAGAAGACGTGCTCAAACGCCTCCAACTT, WBGene00135997   Expr1084214 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24585, AAAAGAAGCGGTTCCAGCGCCACCACTTCGTGTAACTTCTGAAAAGAGCACAGCGCCTGC, WBGene00180157   Expr1074360 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA22615, ACGAAATTCAGACAGGATATTGCTCATTTGAGAGATATTAGCACCCATTTGGCCGCCAAC, WBGene00178187   Expr1076994 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region