WormMine: Gene WBGene00136113

• WormBase Gene ID: WBGene00136113
• Gene Name: Cjp-snu-23
• Sequence Name: CJA16909
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable nucleic acid binding activity and zinc ion binding activity. Predicted to be involved in mRNA splicing, via spliceosome. Predicted to be part of spliceosomal complex. Is an ortholog of C. elegans snu-23.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16909.1	CJA16909.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16909	CJA16909		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082290
• Remark: CJA16909, AAGAGCAACAGGTGGAGCAGCTTCTGGAGGATGTGCAAGAAGAGGAAGCTAGAATGGCGG, WBGene00136113
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region