WormMine: Gene WBGene00136215

• WormBase Gene ID: WBGene00136215
• Gene Name: Cjp-rnp-4
• Sequence Name: CJA17011
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA binding activity. Predicted to be involved in RNA processing. Predicted to be located in cytoplasm and nucleus. Is an ortholog of C. elegans rnp-4. In C. elegans, rnp-4 is involved in several processes, including feminization of hermaphroditic germ-line; nuclear mRNA surveillance; and positive regulation of oogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17011.1	CJA17011.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17011	CJA17011		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087178
• Remark: Cjp-rnp-4, CTCGGTCAGAACGTGAAAGTTGATTGGTGCTTTGTGAAAGGAAAGAAGTCGGCCGGAAAG, WBGene00136215
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region