WormMine: Gene WBGene00136216

• WormBase Gene ID: WBGene00136216
• Gene Name: Cjp-nmr-1
• Sequence Name: CJA17013
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity; ligand-gated monoatomic ion channel activity; and signaling receptor activity. Predicted to be involved in DNA integration; DNA transposition; and monoatomic ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans nmr-1. In C. elegans, nmr-1 is involved in locomotory behavior and regulation of forward locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17013b.1	CJA17013b.1		[unknown]
Transcript:CJA17013a.1	CJA17013a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17013a	CJA17013a		[unknown]
CDS:CJA17013b	CJA17013b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090997
• Remark: Cjp-nmr-1, AACTTGGACCAGAAATGGATCGATCGAGGTGGGCCAAACTGCGTTGTGGAGGCACACAAA, WBGene00136216
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region