WormMine: Gene WBGene00136312

• WormBase Gene ID: WBGene00136312
• Gene Name: Cjp-cat-4
• Sequence Name: CJA17108
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable GTP cyclohydrolase I activity. Predicted to be involved in tetrahydrofolate biosynthetic process. Is an ortholog of C. elegans cat-4. In C. elegans, cat-4 is involved in dopamine biosynthetic process from tyrosine; melanin biosynthetic process; and tetrahydrobiopterin biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17108.1	CJA17108.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17108	CJA17108		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081976
• Remark: Cjp-cat-4, GTCACACATGTGTATGGTGATGCGTGGAGTTCAAAAGATCAACGCCACAACGACGACATC, WBGene00136312
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region