WormMine: Gene WBGene00136421

• WormBase Gene ID: WBGene00136421
• Gene Name: Cjp-cel-1
• Sequence Name: CJA17217
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; mRNA 5'-triphosphate monophosphatase activity; and mRNA guanylyltransferase activity. Predicted to be involved in 7-methylguanosine mRNA capping. Is an ortholog of C. elegans cel-1. In C. elegans, cel-1 is involved in polynucleotide 5' dephosphorylation and positive regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17217.1	CJA17217.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17217	CJA17217		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085179
• Remark: Cjp-cel-1, CGAACGGATAAATCGCTGCCGAATGGAAAACGAACGGCTGATAATGTGCTGGAAACGATG, WBGene00136421
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region