WormMine: Gene WBGene00136469

• WormBase Gene ID: WBGene00136469
• Gene Name: Cjp-ral-1
• Sequence Name: CJA17265
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Predicted to be involved in signal transduction. Predicted to be located in membrane. Is an ortholog of C. elegans ral-1. In C. elegans, ral-1 is involved in several processes, including determination of adult lifespan; multivesicular body assembly; and positive regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17265.1	CJA17265.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17265	CJA17265		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076244
• Remark: Cjp-ral-1, GAGATGAAGCGTCGGAAGGGCGGCGCCGCCACCACGATAGGAATAGACGCATCGGCGAGC, WBGene00136469
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region