WormMine: Gene WBGene00136472

• WormBase Gene ID: WBGene00136472
• Gene Name: CJA17268
• Sequence Name: CJA17268
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable serine-type endopeptidase inhibitor activity. Predicted to be located in extracellular space. Is an ortholog of C. elegans F15D3.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17268b.1	CJA17268b.1		[unknown]
Transcript:CJA17268c.1	CJA17268c.1		[unknown]
Transcript:CJA17268a.1	CJA17268a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17268a	CJA17268a		[unknown]
CDS:CJA17268b	CJA17268b		[unknown]
CDS:CJA17268c	CJA17268c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087943
• Remark: CJA17268, GAAACGCGTATTATGGCGGGAAGAGTCAGCGGTCTGCAATTCAGCATCACTCGTTTTCGA, WBGene00136472
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region