WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136657 Gene Name  Cjp-let-607
Sequence Name  ? CJA17455 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans let-607. In C. elegans, let-607 is involved in several processes, including protein folding; regulation of distal tip cell migration; and regulation of intracellular signal transduction. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA17455b.1 CJA17455b.1   [unknown]
Transcript:CJA17455a.1 CJA17455a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA17455a CJA17455a   [unknown]
CDS:CJA17455b CJA17455b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-let-607, ACCAAACCCGCAACACTACAAGGTGCACGCGCAACAGCAGAAGGTTCAGTATGTGACGAT, WBGene00176287   Expr1074701 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA17455, AAACTGCAAGCCCAGCTGTGCCAAAGTGCGAAACGAAGCACCCAAGCGGGCACATGTCTT, WBGene00136657   Expr1077442 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region