WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136964 Gene Name  Cjp-bro-1
Sequence Name  ? CJA17760 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable transcription coactivator activity. Predicted to be located in nucleus. Is an ortholog of C. elegans bro-1. In C. elegans, bro-1 is involved in several processes, including negative regulation of transcription by RNA polymerase II; nematode male tail tip morphogenesis; and positive regulation of locomotion involved in locomotory behavior. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA17760a.1 CJA17760a.1   [unknown]
Transcript:CJA17760b.1 CJA17760b.1   [unknown]
Transcript:CJA17760c.1 CJA17760c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA17760c CJA17760c   [unknown]
CDS:CJA17760a CJA17760a   [unknown]
CDS:CJA17760b CJA17760b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-bro-1, CAAGACCATTCGTTTTCAATGGAATCTGGGTGAAAGTTGTTGGCACGATGAACTCGGAAT, WBGene00136964   Expr1078873 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  located_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region