WormMine: Gene WBGene00137199

• WormBase Gene ID: WBGene00137199
• Gene Name: Cjp-taf-11.1
• Sequence Name: CJA17994
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein heterodimerization activity. Predicted to be involved in transcription initiation at RNA polymerase II promoter. Predicted to be located in nucleus. Is an ortholog of C. elegans taf-11.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17994.1	CJA17994.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17994	CJA17994		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082017
• Remark: Cjp-taf-11.1, TTGGATATCAGAGATCTAAACTCTGACGAAACCACCCGCCCATTAAAGCCACATCACATT, WBGene00137199
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region