WormMine: Gene WBGene00137228

• WormBase Gene ID: WBGene00137228
• Gene Name: Cjp-alh-5
• Sequence Name: CJA18023
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor. Predicted to be involved in cellular aldehyde metabolic process. Is an ortholog of C. elegans alh-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18023.1	CJA18023.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18023	CJA18023		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075213
• Remark: CJA18023, ACAGTGGAAAATTCGGCTTCGACACTTTTACCCACGAAAAATCGGTGATGATGAGAGATA, WBGene00137228
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region