WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00137270 Gene Name  Cjp-madd-4
Sequence Name  ? CJA18066 Organism  Caenorhabditis japonica
Automated Description  Predicted to be involved in extracellular matrix organization. Is an ortholog of C. elegans madd-4. In C. elegans, madd-4 is involved in dorsal/ventral axon guidance and synapse organization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA18066b.1 CJA18066b.1   [unknown]
Transcript:CJA18066a.1 CJA18066a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA18066b CJA18066b   [unknown]
CDS:CJA18066a CJA18066a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA01739, GGGAACGTGTCAGGTATTTATTTTGCGCTCTATTGATGATGTTTTGTCTAACAATAACTG, WBGene00120943   Expr1074596 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA18066, AAAACTGCAAAGCCGAATGGCGCACGTCGGATTGGGGATCGTGCAGCTCAGAGTGCGGAA, WBGene00137270   Expr1090466 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region