WormMine: Gene WBGene00137278

• WormBase Gene ID: WBGene00137278
• Gene Name: Cjp-frpr-18
• Sequence Name: CJA18074
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans frpr-18. In C. elegans, frpr-18 is involved in G protein-coupled receptor signaling pathway; positive regulation of protein secretion; and sleep.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18074.1	CJA18074.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18074	CJA18074		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092162
• Remark: CJA18074, AACCGCTCTACATGCAGAAAAGACGCGAGCGTTTCTCGTCCGAGTACAACGAAAGAACTT, WBGene00137278
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region