WormMine: Gene WBGene00137529

• WormBase Gene ID: WBGene00137529
• Gene Name: CJA18325
• Sequence Name: CJA18325
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans W03G11.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18325a.1	CJA18325a.1		[unknown]
Transcript:CJA18325c.1	CJA18325c.1		[unknown]
Transcript:CJA18325b.1	CJA18325b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18325c	CJA18325c		[unknown]
CDS:CJA18325a	CJA18325a		[unknown]
CDS:CJA18325b	CJA18325b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073600
• Remark: CJA18325, GACACATTTGCGAGATGGGAGGGTACCGTAATATCACATTATTGAAGTGGCTAGAGTCAA, WBGene00137529
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region