WormMine: Gene WBGene00137673

• WormBase Gene ID: WBGene00137673
• Gene Name: Cjp-asm-1
• Sequence Name: CJA18469
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable sphingomyelin phosphodiesterase activity. Predicted to be involved in sphingomyelin catabolic process. Is an ortholog of C. elegans asm-1. In C. elegans, asm-1 is involved in ceramide biosynthetic process and sphingomyelin catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18469.1	CJA18469.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18469	CJA18469		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082579
• Remark: Cjp-asm-1, ATTAATGTGCAATCTTCGAATGGGTCATCACAATTCGACGCTTTACTGTCCAACTTTTTA, WBGene00137673
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region