WormMine: Gene WBGene00137676

• WormBase Gene ID: WBGene00137676
• Gene Name: Cjp-prp-8
• Sequence Name: CJA18474
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable U5 snRNA binding activity; U6 snRNA binding activity; and metallopeptidase activity. Predicted to be involved in mRNA splicing, via spliceosome. Predicted to be part of spliceosomal complex. Is an ortholog of C. elegans prp-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18474a.1	CJA18474a.1		[unknown]
Transcript:CJA18474b.1	CJA18474b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18474b	CJA18474b		[unknown]
CDS:CJA18474a	CJA18474a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085532
• Remark: Cjp-prp-8, GCGAATCCGAAAGAGTACTATCATGAGGACCATCGACCGGTGCATTTCCACAATTTTAAG, WBGene00137676
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region