WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00137750 Gene Name  Cjp-ttll-11
Sequence Name  ? CJA18546 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable ATP binding activity. Predicted to be involved in protein modification process. Is an ortholog of C. elegans ttll-11. In C. elegans, ttll-11 is involved in response to hermaphrodite contact. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA18546.1 CJA18546.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA18546 CJA18546   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-ttll-11, CACTTGTTAGAGATACTCTGCTACTGATTCTAGGACTTTTGAACGAGGAGTATAATTCAA, WBGene00137750   Expr1071248 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA14334, GCCGTCGCAGTCACCGTCGCAGTCGTAGCCGCTCGGAAAGCGCCAAAAGAAGCAAAAGAC, WBGene00133538   Expr1071374 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA19939, AAGGTTCAAAGATTATTGTCTTTTTGTGATATGAGTCTGAGACATTATGGTGTGAGGTCA, WBGene00175510   Expr1076374 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region