WormMine: Gene WBGene00137790

• WormBase Gene ID: WBGene00137790
• Gene Name: Cjp-gld-1
• Sequence Name: CJA18586
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans gld-1. In C. elegans, gld-1 is involved in several processes, including oocyte fate determination; positive regulation of reproductive process; and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA18586a.1	CJA18586a.1		[unknown]
Transcript:CJA18586b.1	CJA18586b.1		[unknown]
Transcript:CJA18586c.1	CJA18586c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA18586a	CJA18586a		[unknown]
CDS:CJA18586c	CJA18586c		[unknown]
CDS:CJA18586b	CJA18586b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084380
• Remark: Cjp-gld-1, ACAACTCATGGAACTCGCTATAATAAATGGGACCTACCGTCCGATGAAGTCACCAAATCC, WBGene00137790
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region