WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00137924 Gene Name  Cjp-rnf-121
Sequence Name  ? CJA18720 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable metal ion binding activity. Is an ortholog of C. elegans rnf-121. In C. elegans, rnf-121 is involved in ERAD pathway; PERK-mediated unfolded protein response; and inductive cell migration. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA18720.1 CJA18720.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA18720 CJA18720   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA05829, GGAAAAACCACATTTATTCTACGGGAAACTATTGGACTGGGCCCGATATTTAGTATGCTG, WBGene00125033   Expr1084936 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-rnf-121, TTACATTCTTGGAATTATTGGCTACGTGATAATCATGGCCGCGCTGCTTGGATTTAACGT, WBGene00137924   Expr1088037 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region