WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00138153 Gene Name  Cjp-klc-2
Sequence Name  ? CJA18949 Organism  Caenorhabditis japonica
Automated Description  Predicted to be part of kinesin complex. Is an ortholog of C. elegans klc-2. In C. elegans, klc-2 is involved in several processes, including axon extension; establishment of organelle localization; and polar body extrusion after meiotic divisions. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA18949.1 CJA18949.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA18949 CJA18949   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-klc-2, GGTGCTCTTTATCGGAGGCAAGGAAAGTATGAAGCAGCGGAAACACTGGAAGATGTGGCT, WBGene00138153   Expr1084008 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA24599, ATCAATTGGGACTGCACCACGTTCCAATATGACTACCAGCATCTCACAAACAGGATTGAA, WBGene00180171   Expr1087862 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA06267, TGTAACCGGATTTTCTTTCACCCCAGAAGAAATTGCGAATTCAATACGCCGAGTTATACC, WBGene00125471   Expr1077452 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  part_of

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  part_of

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region