WormMine: Gene WBGene00138239

• WormBase Gene ID: WBGene00138239
• Gene Name: Cjp-gpa-17.1
• Sequence Name: CJA19036
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable G-protein beta/gamma-subunit complex binding activity; GTPase activity; and guanyl nucleotide binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway; intracellular protein transport; and vesicle-mediated transport. Predicted to be part of clathrin adaptor complex. Is an ortholog of C. elegans gpa-17.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19036.1	CJA19036.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19036	CJA19036		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072158
• Remark: CJA19036, CACGGCGCCAGGTCGACAATCAACAACTACTGTACCACTCTGTCAAGTACACTAACAATT, WBGene00138239
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

9 GO Annotation

0 Homologues

0 Locations

9 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region