WormMine: Gene WBGene00138329

• WormBase Gene ID: WBGene00138329
• Gene Name: CJA19123
• Sequence Name: CJA19123
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable actin binding activity. Predicted to be involved in actin filament depolymerization. Predicted to be located in actin cytoskeleton. Is an ortholog of C. elegans F53E2.2 and unc-60. In C. elegans, unc-60 is involved in several processes, including actin filament-based process; embryo development; and positive regulation of actin filament polymerization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19123.1	CJA19123.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19123	CJA19123		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085286
• Remark: Cjp-unc-60, CGGAGTCAGTGTTCACCCAGATGTGCCAGCTACTTTCCAAAAATTGTCAGAGGGAAAGAA, WBGene00138329
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region