WormMine: Gene WBGene00138574

• WormBase Gene ID: WBGene00138574
• Gene Name: Cjp-glb-24
• Sequence Name: CJA19368
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable heme binding activity and oxygen binding activity. Is an ortholog of C. elegans glb-24.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19368.1	CJA19368.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19368	CJA19368		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092155
• Remark: Cjp-glb-24, GACACTATCATGGATTGTGCGAGAAGGCGGTGTGAAGCTGTGAGGAAGCATAAAGAGTTA, WBGene00138574
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region